Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2249

[Submit comment/correction]

Locus	MWG2249
Type	RFLP STS
Chromosome	5H
Map	Hordeum-AxK-5H 142.7 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley, AxK [ Show all 6 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	MWG2249
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG2249
Locus	MWG2249 RI037K20
Synonym	Synonym HAR35_45441
STS primers	5' GGCATGTGAGGGAAGCAATGG 5' TGGAGAAGAACGTGTGGGTCG
STS size	327
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234866 MWG2249 MWG2249-5
Source Species	Hordeum vulgare