Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2310

[Submit comment/correction]

Locus	MWG2310
Type	RFLP STS
Chromosome	6H 7H
Map	Hordeum-AxK-6H 27.5 Hordeum-Bins-7H 53 Hordeum-Graner2-7H 81.5 Hv-Consensus2006-Marcel-7H 54.85 Hv-Integrated2009-7H 57.7
	[ Show Nearby Loci ]
Map Data	Barley, AxK Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	MWG2310
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG2310
Locus	MWG2310
Synonym	Synonym HAR35_45392
STS primers	5' GCGAGCTTCAGCAGGTTCAGG 5' CGACGATGCTTGCGCCTTGG
STS size	120
Amplification Conditions	STS annealing temperature 48-50 oC
Sequence	AJ234896 AJ234895 MWG2310 MWG2310-5 MWG2310-3