Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG514A

[Submit comment/correction]

Locus	MWG514A
Type	RFLP
Chromosome	6H
Map	Hv-Consensus2006-Marcel-6H 139.9 Hv-Integrated2009-6H 132.2
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009
Probe	MWG514
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG514 MWG514B MWG514b-5H Xmwg514 Xmwg514-3R
Probe for Locus	MWG514
Locus	MWG514 [ Show all 6 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTGCATTAATACAGTGCCCA 5' CACAAACGTTACGAGTACAG
STS size	472
Amplification Conditions	STS annealing temperature 50-52 oC
Sequence	AJ234478 AJ234477 MWG514-5 MWG514-3
Linkage Group	5H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1