Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG539

[Submit comment/correction]

Locus	MWG539
Type	RFLP
Chromosome	7H
Chromosome Arm	7HL
Map	Barley-Consensus-7H 36.5 [ Show all 7 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHd.IgDa-7H.2
Map Data	Barley consensus [ Show all 7 ]
Probe	MWG539
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg539 Xmwg539-4R
Probe	MWG539
Locus	MWG539 Xmwg539 Xmwg539-4R
Synonym	Synonym HAR35_18113
Type	Genomic STS
STS primers	5' GCACTGCCCAATTCTTGC 5' CTTGATCTCCTTCGGGAGCG
STS size	ca. 900
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234494 AJ234493 MWG539-5 MWG539-3
Linkage Group	7H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.2