Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG553a

[Submit comment/correction]

Locus	MWG553a
Type	RFLP
Chromosome	5H
Map	Barley-Consensus2-5H 117.3 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 6 ]
Probe	MWG553
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG553 MWG553b
Probe for Locus	MWG553
Locus	MWG553b MWG553a MWG553
Type	Genomic STS
STS primers	5' TACAAGAACTCGAGAAAGATGCCA 5' CTGAATTTGTGTGGTGTCTTGTGT
STS size	483
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234502 AJ234501 MWG553-5 MWG553-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare