Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG555

[Submit comment/correction]

Locus	MWG555
Type	RFLP
Synonym	Synonym MWG555b
Chromosome	3H 7H
Map	Barley-ConsensusFHB-3H 80.19 Barley-ConsensusFHB-7H 0 Hordeum-FxS-FHB-QTL-7H 0 Hordeum-Giese2-3H 117 Hordeum-NABGMP2-7H 4.1
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, HxT Barley, VGxTP
Probe	MWG555
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Possible Orthologs	MWG555a MWG555a-7H MWG555b MWG555b-3H
Probe	MWG555
Locus	MWG555 MWG555b MWG555a MWG555a-7H MWG555b-3H
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' CGATTTGTTGGCACACATCA 5' GCAGTATCATCTCACCCGAA
STS size	213
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234503 MWG555-5
Linkage Group	Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.8