Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG583

[Submit comment/correction]

Locus	MWG583
Type	RFLP
Synonym	Synonym MWG583
Chromosome	5H
Map	Barley-Consensus2-5H 91.4 [ Show all 12 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 14 ]
Probe	MWG583
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka,Nure x Tremois Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Probe	MWG583
Locus	MWG583
Type	Genomic STS
STS primers	5' TGTACGCAGGGAAACAGGTCGTTC 5' GTCCAAGCAGAGAGAGAGATTCCG
STS size	350
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234522 MWG583-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare