Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG584

[Submit comment/correction]

Locus	MWG584
Type	CAPS RFLP
Synonym	Synonym MWG584
Chromosome	3 (3H) 3H
Chromosome Arm	3HS
Map	Barley-Consensus-3H -16.5 [ Show all 23 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.HD_5H_5
Map Data	Barley consensus [ Show all 23 ]
Species	Hordeum vulgare
Probe	MWG584
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG584 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	Xmwg584 Xmwg584-3 Xmwg584-3A Xmwg584-4A.1 Xmwg584-4A.2
Probe	MWG584
Locus	Xmwg584-3 [ Show all 6 ]
Synonym	Synonym HAR35_23373 HAR35_30482
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Remarks	Restriction Enzyme for CAPS marker is Stu I
Type	Genomic STS
PCR primers	5' aaggcaagattggacgaggttt 3' 5' aaggcaagattggacgaggttt 3' 5' ttggaggagagcggaagagat 3' 5' ttggaggagagcggaagagat 3'
STS primers	5' GTATTCTTGGAGGAGAGCGG 5' CGAGGTTTACCCTGGAGACG
STS size	365
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 58 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234524 AJ234523 MWG584-5 MWG584-3
Linkage Group	3H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.9