Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG604

[Submit comment/correction]

Locus	MWG604
Type	RFLP
Chromosome	5H
Map	Barley-Consensus2-5H 102.8 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 6 ]
Probe	MWG604
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG604-5H
Probe	MWG604
Locus	MWG604 MWG604-5H
Type	Genomic STS
STS primers	5' GCAGCCGGAGCAGCAAATAGC 5' CTGTCTGTTTGCTGATCTTGTT
STS size	ca. 500
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234533 MWG604-5
Linkage Group	5H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.1