Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG620

[Submit comment/correction]

Locus	MWG620
Type	RFLP STS
Synonym	Synonym MWG620
Chromosome	6H
Chromosome Arm	6HS
Map	Barley-Consensus-6H -53.3 [ Show all 22 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 22 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	MWG620
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG620 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec
Possible Orthologs	MWG620-6H Xmwg620-6A
Probe	MWG620
Locus	MWG620 Xmwg620-6A MWG620-6H
Reference	Sayed-Tabatabaei BE et al. (1998) DNA sequencing and primer designing for RFLP clones evenly distributed in the barley genome. Barley Genetics Newsletter 28:15-18. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	T7 side (5' to 3') TGGTACACGGGGAAGAAATGGATTG T3 side (5' to 3') AAATCTCCCTTGGTCAGTCCGCAGT
Sequence	MWG620
Linkage Group	6H
Source Species	Hordeum vulgare
Insert Size	1