Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG649a

[Submit comment/correction]

Locus	MWG649a
Type	RFLP
Chromosome	7H
Map	Barley-ConsensusFHB-7H 77.8 Hordeum-FxS-FHB-QTL-7H 119.3
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2023, FHB Barley, FxS, FHB QTL
Probe	MWG649
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Possible Orthologs	MWG649b Xmwg649
Probe for Locus	MWG649
Locus	Xmwg649 MWG649a MWG649b
Synonym	Please see cMWG649
Reference	Kunzel G et al. (2000) Integration of deletion breakpoints of chromosome 7H (1) into the Igri/Franka-derived RFLP Barley Genetics Newsletter 30:24-27. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks	cMWG649 is the correct designation. MWG649 does not exist. (Personal communication from Andreas Graner, September 2005.)
STS primers	5' CAACACTCCGTCAACCAGCAACCTC 5' GCCTGCGTTGTTGAATGCG
STS size	441
Amplification Conditions	STS annealing temperature 55 - 58 oC