Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG652

[Submit comment/correction]

Locus	MWG652
Type	CAPS RFLP
Synonym	Synonym MWG652A MWG652B
Chromosome	6H
Map	Barley-Consensus2-6H 19.5 Hordeum-NABGMP2-6H 20.2 Hordeum-RxK-NTNB-6H 41.6 Leymus_2012_con_LG6b 17.614 Leymus_2012_TTC2_LG6b 12.613
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley, HxT Barley, Rika/Kombar NTNB, 6H Leymus_2012_TTC2 Leymus_2012_TTCC
Species	Hordeum vulgare
Probe	cMWG652 MWG652
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270.
Possible Orthologs	MWG652A MWG652B Xmwg652 Xmwg652-6A
Probe for Locus	cMWG652
Locus	Xcmwg652-6 [ Show all 19 ]
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks	Restriction enzyme informative in CAP analysis is HaeIII
Type	cDNA STS
STS primers	5' GAGCTGCTCGTTCTCGTTGA 5' CACACCTTCTTCTTCCTCTT
STS size	417
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234405 AJ234404 CMWG652-5 CMWG652-3
Linkage Group	6H 6
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	1