Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG803

[Submit comment/correction]

Locus	MWG803
Type	RFLP
Chromosome	3H
Chromosome Arm	3HL
Map	Barley-Consensus-3H 56.9 [ Show all 10 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.HT_3H_6 MetaQ.HT_3H_8
Map Data	Barley consensus [ Show all 10 ]
Probe	MWG803
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg803-3
Probe	MWG803
Locus	Xmwg803-3 MWG803 HI071H3 HD071H3
Synonym	Synonym HAR35_15589
Type	Genomic STS
STS primers	5' GGTCTTTTCCAACGCACTATCCAGCC 5' CCCAGAAGAAAACACAGGCCCACAA
STS size	442
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234562 MWG803-5
Linkage Group	3H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	3