Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG807

[Submit comment/correction]

Locus	MWG807
Type	RFLP
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-Consensus-7H -65.4 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 6 ]
Probe	MWG807
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG807
Locus	MWG807
Synonym	Synonym HAR35_334 HAR35_449 HAR35_48483
Type	Genomic STS
STS primers	5' TACTGGGTGTTCGGTGTGGC 5' AATTCCTGCATTCCAAACGG
STS size	337
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234564 AJ234563 MWG807-5 MWG807-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare