Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG820

[Submit comment/correction]

Locus	MWG820
Type	RFLP
Synonym	Synonym MWG820
Chromosome	6H
Chromosome Arm	6HL
Map	Barley-consensus-2003-6H 57.2 [ Show all 28 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QGms.HaTR-6H QHd.IgTr-6H.1
Map Data	Barley consensus [ Show all 28 ]
Species	Hordeum vulgare
Probe	MWG820
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. [ Show all 6 ]
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of MWG820 in the Barley, Consensus 2006 DArT maps = 3 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG820-6H [ Show all 8 ]
Probe	MWG820
Locus	MWG820 [ Show all 9 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GGGGAGAAAATGCATGCAAT 5' CAGCGTCGTATAAATGTCTT
STS size	265
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234573 AJ234572 MWG820-5 MWG820-3
Linkage Group	6H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.5