Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG887b

[Submit comment/correction]

Locus	MWG887b
Type	RFLP
Chromosome	6H
Map	Barley-Consensus2-6H 40.3 [ Show all 7 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_6H_4 QFhs.umn-6H .1
Map Data	Barley consensus 2 [ Show all 7 ]
Probe	MWG887
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG887a Xmwg887-6A.1 Xmwg887-6A.2
Probe for Locus	MWG887
Locus	Xmwg887-6A.1 MWG887a MWG887b
Type	Genomic STS
STS primers	5' GAAGATGTCAATCAAGGGTT 5' CAGCCTACAAGCAGACAAAA
STS size	276
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234621 AJ234620 MWG887-5 MWG887-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare