Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG889A

[Submit comment/correction]

Locus	MWG889A
Type	RFLP
Chromosome	2H
Map	Barley-ConsensusFHB-2H 42.23 Hordeum-Bins-2H 47 Hordeum-Consensus2006-DArT-2H 43.9 Hv-Consensus2006-Marcel-2H 44.04 Hv-Integrated2009-2H 41.3
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009
Probe	MWG889
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Kleinhofs, Andris
Remark	Number of populations contributing to the placement of MWG889A in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG889 MWG889(HT) MWG889(IF) MWG889-2H MWG889B
Probe for Locus	MWG889
Locus	MWG889 [ Show all 6 ]
Type	Genomic STS
STS primers	5' CCCTGAATTCACGCGTTATT 5' GAATGAGCAACTACCGCATA
STS size	378
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234623 AJ234622 MWG889-5 MWG889-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare