Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG911

[Submit comment/correction]

Locus	MWG911
Type	RFLP
Synonym	Synonym MWG911B
Chromosome	6H 7H
Chromosome Arm	6HL
Map	Barley-Consensus-6H 70.3 Hordeum-Consensus2006-DArT-7H 73 Hordeum-Graner2-6H 125 Hordeum-SxM-base-7H 76.3 Hordeum-SxM-SSAP-7H 72.8
	[ Show Nearby Loci ]
QTL with Locus Marker	QHt.IgDa-6H QScd.IgDa-6H.2
Map Data	Barley consensus [ Show all 7 ]
Probe	MWG911
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
Remark	Number of populations contributing to the placement of MWG911 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	MWG911(IF) MWG911(SM) MWG911A MWG911a-6H MWG911B
Probe	MWG911
Locus	MWG911 [ Show all 6 ]
Type	Genomic STS
STS primers	5' GATGTCGTCGACGTAGAGAA 5' CATGGCCTGTACATCAGCTT
STS size	291
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234641 MWG911-5
Linkage Group	Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.7