Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG961

[Submit comment/correction]

Locus	MWG961
Type	RFLP
Chromosome	3H
Chromosome Arm	3HL
Map	Barley-Consensus-3H 43.7 [ Show all 7 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.KPS_3H_2
Map Data	Barley consensus [ Show all 7 ]
Probe	MWG961
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg961 Xmwg961-3 Xmwg961-3A mwg961
Probe	MWG961
Locus	Xmwg961-3 [ Show all 6 ]
Synonym	Synonym HAR35_6453 HAR35_7101
Type	Genomic STS
STS primers	5' GCCGAACCTGAGCTTGTACA 5' CGCTATCCTCGAGTACGACT
STS size	449
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234680 AJ234679 MWG961-5 MWG961-3
Polymorphism	MWG961 XbaI
Linkage Group	3
Insert Enzyme	PstI
Source Species	Hordeum vulgare