Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG975

[Submit comment/correction]

Locus	MWG975
Type	RFLP STS
Chromosome	3H 7H
Chromosome Arm	3HL
Map	Barley-Consensus-3H 15.8 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	MWG975
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg975 Xmwg975-7B Xmwg975-7D
Probe	MWG975
Locus	MWG975 [ Show all 6 ]
Synonym	Synonym HAR35_19914 HAR35_8093 HAR35_8094
Type	Genomic STS
STS primers	5' GATTGCCACATCGCGAACAGGCCTGC 5' GTACTGCGTGGTTGTGGACGTGGCTT
STS size	178
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234692 AJ234691 MWG975 MWG975-5 MWG975-3
Polymorphism	MWG975 DraI
Insert Enzyme	PstI
Source Species	Hordeum vulgare