Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: PBI21c

[Submit comment/correction]

Locus	PBI21c
Type	RFLP
Chromosome	3H
Map	Barley-Consensus2-3H 43.1 Hordeum-Bins-3H 68 Hordeum-Graner2-3H 55.6 Hv-Consensus2006-Marcel-3H 51.27 Hv-Integrated2009-3H 61.7
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	PBI21
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	PBI21a PBI21b
Probe for Locus	PBI21
Locus	PBI21a PBI21c PBI21b
Type	Genomic STS
STS primers	5' TAATGGCGTGCTATACAGACC 5' CATGACTAGGCATAATTGGC
STS size	258
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	BH854327 BH854326 PBI21-5 PBI21-3
Source Species	Hordeum vulgare