Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Rht13

[Submit comment/correction]

Locus	Rht13
Type	Trait
Chromosome	7B
Chromosome Arm	7BS
Map	Wheat-Composite2004-7B 105
	[ Show Nearby Loci ]
Species	Triticum aestivum
Probe	WMS577
Associated Gene	Rht13 (Triticum)
Gene Class	Reduced height
Reference	Ellis MH et al. (2005) Molecular mapping of gibberellin-responsive dwarfing genes in bread wheat Theoretical and Applied Genetics 111:423-430.
Remark	Trait marker Xwms577-7B Nearby marker on Composite map: Xgwm577 Position on Composite map estimated by GrainGenes.
Probe for Locus	WMS577
Locus	Xgwm577-7B [ Show all 12 ]
Reference	Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks	Insert contains repeat (CA)14(TA)6 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. In 369 Avena sterilis accessions there were 2 alleles of size 50-55 bp, PIC = negative.
Type	Genomic PCR SSR
PCR primers	5' ATGGCATAATTTGGTGAAATTG 3' 5' TGTTTCAAGCCCAACTTCTATT 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS577
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring