Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: SrR

[Submit comment/correction]

Locus	SrR
Type	Gene Trait
Chromosome	1D
Species	Triticum aestivum
Probe	IB-267 MWG60
Associated Gene	SrR (Triticum)
Gene Class	Reaction to Puccinia graminis Pers.
Reference	Mago R et al. (2004) Resistance genes for rye stem rust (SrR) and barley powdery mildew (Mla) are located in syntenic regions on short arm of chromosome Genome 47:112-121. Mago R et al. (2002) Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat-rye translocation lines Theoretical and Applied Genetics 104:1317-1324.
Remark	On a translocated segment of 1RS from rye 'Imperial'. Trait marker RGA39, IB-267
Probe for Locus	IB-267
Locus	SrR
Reference	Mago R et al. (2002) Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat-rye translocation lines Theoretical and Applied Genetics 104:1317-1324.
Type	STS
STS primers	5' GCAAGTAAGCAGCTTGATTTAGC 3' 5' AATGGATGTCCCGGTGAGTGG 3'