Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: UMB102

[Submit comment/correction]

Locus	UMB102
Type	Microsatellite
Chromosome	7H
Species	Hordeum vulgare
Probe	UMB102
Reference	Beaubien KA and Smith KP (2006) New SSR markers for barley derived from the EST database Barley Genetics Newsletter 30:30-43.
Remark	Marker polymorphic in : Atahualpa x M81; Harrington x OUH602; Hor211 x Lacey; Steptoe x Morex Marker mapped in : Steptoe x Morex Quality Score = 2.5 (1=Very easy to score and 5=Very hard to score) Number of alleles = 2
Probe	UMB102
Locus	UMB102
Reference	Beaubien KA and Smith KP (2006) New SSR markers for barley derived from the EST database Barley Genetics Newsletter 30:30-43.
Remarks	See reference for PCR and amplification conditions
Type	SSR
PCR primers	TTGTGTTTGAGATATCCTGTACTTTTC ACCTTTTGCCGGCTTTTATT
Sequence	CB881209