Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: UMB701

[Submit comment/correction]

Locus	UMB701
Type	Microsatellite
Chromosome	5H
Species	Hordeum vulgare
Probe	UMB701
Reference	Beaubien KA and Smith KP (2006) New SSR markers for barley derived from the EST database Barley Genetics Newsletter 30:30-43.
Remark	Marker polymorphic in : Atahualpa x M81; Frederickson x Stander; Harrington x OUH602 Marker mapped in : Frederickson x Stander Quality Score = 2 (1=Very easy to score and 5=Very hard to score) Number of alleles = 2
Probe	UMB701
Locus	UMB701
Reference	Beaubien KA and Smith KP (2006) New SSR markers for barley derived from the EST database Barley Genetics Newsletter 30:30-43.
Remarks	See reference for PCR and amplification conditions
Type	SSR
PCR primers	ACGTCGTGGATCAACGTGTA TTACATTGCGCACAGCTAGG
Sequence	BE421177