Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WBE104

[Submit comment/correction]

Locus	WBE104
Type	CAPS
Chromosome	4H
Map	Hv-Consensus2006-Marcel-4H 126.38 Hv-Integrated2009-4H 135.8 Hv-L94/Vada-2006-4H 102.42
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, L94 x Vada, 2006
Species	Hordeum vulgare
Probe	WBE104
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec
Probe	WBE104
Locus	WBE104
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Remarks	Restriction Enzyme for CAPS marker is Psu I
PCR primers	5' atggcatcctcctgttccttcctt 3' 5' cgggctgatgggggttgg 3'
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 61 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Source Species	Hordeum vulgare