Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WBE208

[Submit comment/correction]

Locus	WBE208
Type	STS
Chromosome	6H
Map	Hv-Consensus2006-Marcel-6H 37.01 Hv-Integrated2009-6H 32.5
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, Vada x SusPtrit
Probe	WBE208
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Vada x SusPtrit Map position not determined on Vada x SusPtrit map Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Vada x SusPtrit
Probe	WBE208
Locus	WBE208
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Type	PCR
PCR primers	5' acgtcgtcgagtggttgatgtg 3' 5' agttttggcgtggtccttttg 3'
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 58 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Source Species	Hordeum vulgare