Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WG541

[Submit comment/correction]

Locus	WG541
Type	RFLP
Synonym	Synonym WG541
Chromosome	5H
Chromosome Arm	5HL
Map	Barley-Consensus-5H 0.1 [ Show all 14 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 15 ]
Probe	WG541
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of WG541 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	Xcnl.WG541 Xwg541
Probe	WG541
Locus	WG541 Xcnl.WG541 HD030K11 Xwg541
Synonym	Synonym HAR35_20759 HAR35_26572 HAR35_4256
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TCCAACCAAAGGAACGAAGG AATTCGATCGCACCGTCGGA
Sequence	WG541 WG541-5 WG541-3
Linkage Group	[b 7LS]
Insert Enzyme	PstI
Source Species	Triticum aestivum
Insert Size	1.4