Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WG622

[Submit comment/correction]

Locus	WG622
Type	RFLP
Synonym	Synonym WG622
Chromosome	4H
Chromosome Arm	4HS
Map	Barley-Consensus-4H -59.1 [ Show all 25 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QBgnm.StMo-4H QHt.StMo-4H.1 QPg.PrNu-4H QSsg.StMo-4H
Map Data	Barley consensus [ Show all 26 ]
Probe	WG622
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of WG622 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	WG622-4H [ Show all 9 ]
Probe	WG622
Locus	WG622 [ Show all 10 ]
Synonym	Synonym HAR35_12464 HAR35_28899 HAR35_43418
Type	Genomic STS
PCR primers	AGGTGGGACTGGAACCTGCATC CTCCTGTCAAACTGTTCCCTGA
STS primers	5' CTGCCTGTTGATTTTCCATG 5' TTCACCTTGCCATGACGA
STS size	161
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	BH854377 BH854376 WG622-5 WG622-3
Polymorphism	WG622 EcoRV
Linkage Group	[b 4S]
Insert Enzyme	PstI
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring
Insert Size	1.8