Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WG669

[Submit comment/correction]

Locus	WG669
Type	RFLP
Chromosome	7A 7B 7D 7H
Chromosome Arm	7AS 7BS 7HL
Map	Barley-Consensus-7H 1.1 Barley-Consensus2-7H 75.4 Hordeum-Bins-7H 73
	[ Show Nearby Loci ]
Map Data	Barley consensus Barley consensus 2 Barley, BinMap 2005 Wheat chromosome arm map
Probe	WG669
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	Xcnl.WG669 Xwg669 Xwg669-5B
Probe	WG669
Locus	WG669 Xcnl.WG669 Xwg669-5B Xwg669
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	GAAGGAAAGGTTCCCCATCC AAAGGAGGAGCCCAGTGATT
Sequence	WG669
Linkage Group	7S [b 1S] 7S [b 1S]
Insert Enzyme	PstI
Source Species	Triticum aestivum
Insert Size	0.7