Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xabg458-6B

[Submit comment/correction]

Locus	Xabg458-6B
Type	STS
Map	Tturgidum-Du-6B -9.9
	[ Show Nearby Loci ]
Map Data	T. turgidum, durum x dicoccoides
Probe	ABG458
Remark	In map Tturgidum-Du-6B, this locus was mapped within the indicated interval, based on data from a different RSL population.
Possible Orthologs	ABG458 [ Show all 7 ]
Probe for Locus	ABG458
Locus	ABG458 [ Show all 6 ]
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
General Remarks	Restriction enzyme informative in CAP analysis is RsaI Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' GAGAGCCGATGACGGTATGT 5' CTTGGACACATGCCATATCC
STS size	248
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	L43996 ABG458 ABG458-5
Linkage Group	6S
Source Species	Hordeum vulgare
Insert Size	0.4