Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc107

[Submit comment/correction]

Locus	Xbarc107
Type	Microsatellite
Synonym	Other name barc107 Xbarc107-6A
Chromosome	6A
Map	Wheat, Avalon x Cadenza 6A 78.2 Wheat, UC1110 x PI610750 6A 90.8 Wheat-Composite2004-6A 90
	[ Show Nearby Loci ]
Map Data	Wheat, Avalon x Cadenza Wheat, Composite, 2004 Wheat, UC1110 x PI610750
Probe	BARC107
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc107-6A barc107 barc107-6A
Probe for Locus	BARC107
Locus	Xbarc107-6A Xbarc107 barc107 barc107-6A
General Remarks	Contains motif : (ATT)16 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' CGAACTGAAACTGAAAACACAGACATC 3' 5' AGGGAGAGTGGACGTCATAATTTGTG 3'
Amplification Conditions	Annealing temperature = 50
Sequence	BV211404
Source Species	Triticum aestivum