Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc117

[Submit comment/correction]

Locus	Xbarc117
Type	Microsatellite
Chromosome	5A
Map	Ta-NxW-5A 70.1 Wheat, Finch x Eltan 5A 48.4 Wheat, UC1110 x PI610750 5A 41.5 Wheat-Composite2004-5A 18
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004 Wheat, Finch x Eltan Wheat, Nanda2419 x Wangshuibai Wheat, UC1110 x PI610750
Probe	BARC117
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc117-5A barc117 barc117-5A barc117b-5A
Probe for Locus	BARC117
Locus	Xbarc117-5A Xbarc117 barc117b-5A barc117 barc117-5A
General Remarks	BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' TCATGCGTGCTAAGTGCTAA 3' 5' GAGGGCAGGAAAAAGTGACT 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211325
Source Species	Triticum aestivum