Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc128-7D

Locus	Xbarc128-7D
Type	Microsatellite
Chromosome	7D
Map	Ta-Grandin/BR34-7D 151.3 Ta-SSR-2004-7D 89.2 Wheat, UC1110 x PI610750 7D 120.2
	[ Show Nearby Loci ]
Map Data	Wheat, Consensus SSR, 2004 Wheat, Grandin x BR34 Wheat, UC1110 x PI610750
Probe	BARC128
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157. Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs	Xbarc128 [ Show all 28 ]
Probe for Locus	BARC128
Locus	Xbarc128a-2B [ Show all 29 ]
General Remarks	BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGGGTAGCATTTATGTTGA 3' 5' CAAACCAGGCAAGAGTCTGA 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211430
Source Species	Triticum aestivum