Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc148

[Submit comment/correction]

Locus	Xbarc148
Type	Microsatellite
Chromosome	1A
Map	Ta-NxW-1A 55 Wheat, UC1110 x PI610750 1A 43 Wheat, WH542 x Synthetic 1A 0 Wheat-Composite2004-1A 43
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004 Wheat, Nanda2419 x Wangshuibai Wheat, UC1110 x PI610750 Wheat, WH542 x Synthetic
Probe	BARC148
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc148-1A [ Show all 7 ]
Probe for Locus	BARC148
Locus	Xbarc148-1A [ Show all 8 ]
General Remarks	BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGCAACCACAATGTATGCT 3' 5' GGGGTGTTTTCCTATTTCTT 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211629
Source Species	Triticum aestivum