Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc154-7D

[Submit comment/correction]

Locus	Xbarc154-7D
Type	Microsatellite
Chromosome	7D
Map	Chinese_Spring_Deletion_SSR_7D -0.805 CS/SQ1-7D 84.2 Ta-SSR-2004-7D 62.4 Ta-Synthetic/Opata-BARC-7D 21.1 Wheat, UC1110 x PI610750 7D 71.7
	[ Show Nearby Loci ]
Breakpoint Interval	7DS4-0.61-1.00
Map Data	Wheat, Chinese Spring x SQ1 Wheat, Consensus SSR, 2004 Wheat, Physical, SSR Wheat, Synthetic x Opata, BARC Wheat, UC1110 x PI610750
Probe	BARC154
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157. Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs	Xbarc154 Xbarc154-7A barc154 barc154-7A barc154-7D
Probe for Locus	BARC154
Locus	Xbarc154-7D [ Show all 6 ]
General Remarks	Contains motif : (CT)16 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GTAATTCCGGTTCCACTTGACATT 3' 5' GGATGGGCAGCTTCAAGGTATGTT 3'
Amplification Conditions	Annealing temperature = 50
Sequence	BV211306
Source Species	Triticum aestivum