Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc32

[Submit comment/correction]

Locus	Xbarc32
Type	Microsatellite
Chromosome	5B
Map	Ta-NxW-7B 192.2 Wheat, Avalon x Cadenza 7B 67.4 Wheat-Composite2004-5B 33
	[ Show Nearby Loci ]
Map Data	Wheat, Avalon x Cadenza Wheat, Composite, 2004 Wheat, Nanda2419 x Wangshuibai
Probe	BARC32
Possible Orthologs	Xbarc32-5B [ Show all 15 ]
Probe for Locus	BARC32
Locus	Xbarc32-7B [ Show all 17 ]
Reference	Ren RS et al. (2012) Characterization and molecular mappingof Yr52 for high-temperature adult-plant resistance to stripe rust in spring wheat germplasm PI 183527 Theoretical and Applied Genetics 125:847-857. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe Rust Resistance. Yr59 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks	Contains motif : (TAA)10 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGTGAATCCGGAAACCCAATCTGTG 3' 5' TGGAGAACCTTCGCATTGTGTCATTA 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211664
Source Gene	Yr59 (Triticum)
Source Species	Triticum aestivum