Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc75-3B

[Submit comment/correction]

Locus	Xbarc75-3B
Type	Microsatellite
Chromosome	3B
Chromosome Arm	3BS
Map	Chinese_Spring_Deletion_SSR_3B -0.89 [ Show all 6 ]
	[ Show Nearby Loci ]
Breakpoint Interval	3BS-3/Telomere 3BS8-0.78-1.00
Map Data	Wheat, Chinese Spring x SQ1 [ Show all 6 ]
Probe	BARC75
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Liu SX and Anderson JA (2003) Marker assisted evaluation of Fusarium head blight resistant wheat germplasm Crop Science 43:760-766.
Possible Orthologs	barc75 [ Show all 6 ]
Probe for Locus	BARC75
Locus	Xbarc75-3B [ Show all 7 ]
General Remarks	Contains motif : (TAG)2(TAGA)5 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' AGGGTTACAGTTTGCTCTTTTAC 3' 5' CCCGACGACCTATCTATACTTCTCTA 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211450
Source Species	Triticum aestivum