Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc78

[Submit comment/correction]

Locus	Xbarc78
Type	Microsatellite
Chromosome	4A
Map	Wheat, Avalon x Cadenza 4A2 13.7 Wheat, UC1110 x PI610750 4A 128.8 Wheat, WH542 x Synthetic 4A 70.9 Wheat-Composite2004-4A 139
	[ Show Nearby Loci ]
Map Data	Wheat, Avalon x Cadenza Wheat, Composite, 2004 Wheat, UC1110 x PI610750 Wheat, WH542 x Synthetic
Probe	BARC78
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc78-4A [ Show all 8 ]
Probe for Locus	BARC78
Locus	Xbarc78-4A [ Show all 9 ]
General Remarks	Contains motif : (TC)27(TATC)43 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' CTCCCCGGTCAAGTTTAATCTCT 3' 5' GCGACATGGGAATTTCAGAAGTGCCTAA 3'
Amplification Conditions	Annealing temperature = 55
Sequence	BV211798
Source Species	Triticum aestivum