Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc79

[Submit comment/correction]

Locus	Xbarc79
Type	Microsatellite
Chromosome	6B
Map	Ta-NxW-6B 109.6 Wheat, Finch x Eltan 6B 50 Wheat, UC1110 x PI610750 6B 72.8 Wheat-Composite2004-6B 125
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004 Wheat, Finch x Eltan Wheat, Nanda2419 x Wangshuibai Wheat, UC1110 x PI610750
Probe	BARC79
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc79-6B barc79 barc79-6B
Probe for Locus	BARC79
Locus	Xbarc79-6B Xbarc79 barc79 barc79-6B
General Remarks	Contains motif : (TAGA)10 + (TC)9 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGTTGGAAAGGAGGTAATGTTAGATAG 3' 5' TCGTGGGTTACAAGTTTGGGAGGTCA 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211686
Source Species	Triticum aestivum