Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xcfa2049-7A

[Submit comment/correction]

Locus	Xcfa2049-7A
Type	Microsatellite
Chromosome	7A
Chromosome Arm	7AS
Map	Chinese_Spring_Deletion_SSR_7A -0.74 T.b.xT.m.-7A 93.5 Ta-SSR-2004-7A 32 Ta-Synthetic/Opata-GPW-7A 60.9 Triticum-AxF-7A 56.1
	[ Show Nearby Loci ]
QTL with Locus Marker	QGw1.inra-7A
Breakpoint Interval	7AS5-0.59-0.89
Map Data	T. boeoticum x monococcum Wheat, Arina x Forno Wheat, Consensus SSR, 2004 Wheat, Physical, SSR Wheat, Synthetic x Opata, GPW
Species	Triticum aestivum
Probe	CFA2049
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Paillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs	Xcfa2049 cfa2049 cfa2049-7A
Probe for Locus	CFA2049
Locus	Xcfa2049-7A Xcfa2049 cfa2049 cfa2049-7A
Reference	Sourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks	Quality Score = B Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems) Amplifies motif: (GA)21 Regularity of motif is perfect
Type	PCR SSR
PCR primers	Forward 5' TAATTTGATTGGGTCGGAGC 3' Reverse 5' CGTGTCGATGGTCTCCTTG 3'
SSR size	164
Amplification Conditions	5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group	7A
Source Species	Triticum urartu