Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm11-1B

[Submit comment/correction]

Locus	Xgwm11-1B
Type	Microsatellite
Chromosome	1B
Chromosome Arm	1BL 1BS
Map	Chinese_Spring_Deletion_SSR_1B -0.95 [ Show all 12 ]
	[ Show Nearby Loci ]
Breakpoint Interval	1BS9-0.84-1.06
Map Data	T. turgidum, JK x Cham1 [ Show all 12 ]
Species	Triticum aestivum
Probe	WMS11
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Paillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
Data Source	Roeder, Marion S. 98.09.15
Remark	In Map Ta-Synthetic/Opata-SSR-1B, the interval most likely to contain locus is between Xbcd1124 and Xcdo1173
Possible Orthologs	Xgwm11 gwm11 gwm11-1B gwm11-1A
Probe for Locus	WMS11
Locus	Xgwm11-1B Xgwm11 gwm11 gwm11-1B gwm11-1A
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (TA)6CATA(CA)19(TA)6 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (TA)x6CATA(CA)x19(TA)x6. Product size 196 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' GGATAGTCAGACAATTCTTGTG 3' 5' GTGAATTGTGTCTTGTATGCTTCC 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS11
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring