Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm18-1B

[Submit comment/correction]

Locus	Xgwm18-1B
Type	Microsatellite
Chromosome	1B
Chromosome Arm	1BS
Map	Chinese_Spring_Deletion_SSR_1B -0.25 [ Show all 7 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QLd.sfr-1B QLr.sfr-1B QLtn.sfr-1B
Breakpoint Interval	C-1BS10-0.50
Map Data	T. turgidum, Messapia x dicoccoides, SSR [ Show all 7 ]
Probe	WMS18
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source	Roeder, Marion S. 98.09.15
Remark	In Map Ta-Synthetic/Opata-SSR-1B, the interval most likely to contain locus is between Xbcd1124 and Xcdo1173
Possible Orthologs	Xgwm18 [ Show all 6 ]
Probe for Locus	WMS18
Locus	Xgwm18 [ Show all 7 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (CA)17GA(TA)4 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (CA)x17GA(TA)x4. Product size 186 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' TGGCGCCATGATTGCATTATCTTC 3' 5' GGTTGCTGAAGAACCTTATTTAGG 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS18
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring