Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm2

[Submit comment/correction]

Locus	Xgwm2
Type	Microsatellite
Chromosome	3A
Map	Ta-NxW-3A 67.9 Wheat, UC1110 x PI610750 3A 76.1 Wheat-Composite2004-3A 72 Wheat_Yr76_2016-3A 47.7 Wheat_Yr79_2018-3AL 68
	[ Show Nearby Loci ]
QTL with Locus Marker	QyrPI182103.wgp-3AL
Map Data	Wheat, Composite, 2004 Wheat, Nanda2419 x Wangshuibai Wheat, UC1110 x PI610750 Wheat_Yr76_2016 Wheat_Yr79_2018
Probe	WMS2
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xgwm2-3A [ Show all 10 ]
Probe for Locus	WMS2
Locus	Xgwm2-3A [ Show all 12 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (CA)18 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (CA)x18. Product size 132 bp in Cheyenne.
Type	PCR SSR
PCR primers	5' CTGCAAGCCTGTGATCAACT 3' 5' CATTCTCAAATGATCGAACA 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS2
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring