Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm2-3A

[Submit comment/correction]

Locus	Xgwm2-3A
Type	Microsatellite
Chromosome	3A
Chromosome Arm	3AS
Map	Chinese_Spring_Deletion_SSR_3A -0.725 [ Show all 13 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QFhs.ndsu-3AS QFhs.ndsu.3AS
Breakpoint Interval	3AS4-0.45-1.00
Map Data	T. turgidum, Omrabi5 x dicoccoides, QTL [ Show all 13 ]
Probe	WMS2
QTL Linked with Locus	QFhs.ndsu-3AS
Associated Gene	S-A1 (Triticum)
Gene Class	Sphaerococcum
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Otto CD et al. (2002) Genetic dissection of a major Fusarium head blight QTL in tetraploid wheat Plant Molecular Biology 48:625-632. Salina E et al. (2000) Microsatellite mapping of the induced sphaerococcoid mutation genes in Triticum aestivum Theoretical and Applied Genetics 100:686-689. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source	Roeder, Marion S. 98.09.15
Remark	In Map Ta-Synthetic/Opata-SSR-3A, the interval most likely to contain locus is between Xcdo638 and Xpsr903
Possible Orthologs	Xgwm2 [ Show all 10 ]
Probe for Locus	WMS2
Locus	Xgwm2-3A [ Show all 12 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (CA)18 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (CA)x18. Product size 132 bp in Cheyenne.
Type	PCR SSR
PCR primers	5' CTGCAAGCCTGTGATCAACT 3' 5' CATTCTCAAATGATCGAACA 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS2
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring