Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm3

[Submit comment/correction]

Locus	Xgwm3
Type	Microsatellite
Chromosome	3D
Map	Ta-NxW-3D 143.9 Wheat, UC1110 x PI610750 3D 120.3 Wheat-Composite2004-3D 97
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004 Wheat, Nanda2419 x Wangshuibai Wheat, UC1110 x PI610750
Probe	WMS3
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xgwm3-2D Xgwm3-3D Xgwm3b gwm3
Probe for Locus	WMS3
Locus	Xgwm3-3D [ Show all 7 ]
Reference	Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (CA)18 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (CA)x18. Product size 84 bp in Cheyenne. In 369 Avena sterilis accessions there were 3 alleles of size 44-50 bp, PIC = negative.
Type	Genomic PCR SSR
PCR primers	5' GCAGCGGCACTGGTACATTT 3' 5' AATATCGCATCACTATCCCA 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS3
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring