Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm33-1A

[Submit comment/correction]

Locus	Xgwm33-1A
Type	Microsatellite
Chromosome	1A
Chromosome Arm	1AS
Map	Chinese_Spring_Deletion_SSR_1A -0.93 [ Show all 8 ]
	[ Show Nearby Loci ]
Breakpoint Interval	1AS3-0.86-1.00
Map Data	T. boeoticum x monococcum [ Show all 8 ]
Probe	WMS33
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
Data Source	Roeder, Marion S. 98.09.15
Possible Orthologs	Xgwm33 [ Show all 13 ]
Probe for Locus	WMS33
Locus	Xgwm33-1A [ Show all 14 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (GA)19 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (GA)x19. Product size 123 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' GGAGTCACACTTGTTTGTGCA 3' 5' CACTGCACACCTAACTACCTGC 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS33
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring