Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm46

[Submit comment/correction]

Locus	Xgwm46
Type	Microsatellite
Chromosome	7B
Chromosome Arm	7BL
Map	Tt-LxG-7B 74.9 Wheat, UC1110 x PI610750 7B 93.7 Wheat-2002-ColeoptileColor-7B 47
	[ Show Nearby Loci ]
Map Data	T. turgidum, Langdon x G18-16 Wheat, 2002, coleoptile color Wheat, UC1110 x PI610750
Probe	WMS46
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xgwm46-7B Xgwm46a Xgwm46b gwm46 gwm46-7B
Probe for Locus	WMS46
Locus	Xgwm46 [ Show all 6 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (GA)2GC(GA)33 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeats type (GA)x2GC(GA)x33. Product size 187 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' GCACGTGAATGGATTGGAC 3' 5' TGACCCAATAGTGGTGGTCA 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS46
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring