Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm6

[Submit comment/correction]

Locus	Xgwm6
Type	Microsatellite
Chromosome	4D 5R
Chromosome Arm	5RL
Map	Rye-2009-Consensus-5R 80.5 Secale-PxP-update-5R 156.8 Ta-NxW-4B 50.6 Wheat, UC1110 x PI610750 4B 56.6 Wheat-Composite2004-4D 142
	[ Show Nearby Loci ]
Map Data	Rye, P87 x P105, update Rye_2009_consensus Wheat, Composite, 2004 Wheat, Nanda2419 x Wangshuibai Wheat, UC1110 x PI610750
Probe	WMS6
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	WMS6 [ Show all 17 ]
Probe for Locus	WMS6
Locus	Xgwm6.1-4B [ Show all 18 ]
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (GA)40 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (GA)x40. Product size 205 bp in Cheyenne. In 369 Avena sterilis accessions there were 3 alleles of size 48-60 bp, PIC = negative.
Type	Genomic PCR SSR
PCR primers	5' CGTATCACCTCCTAGCTAAACTAG 3' 5' AGCCTTATCATGACCCTACCTT 3' CGTATCACCTCCTAGCTAAACTAG AGCCTTATCATGACCCTACCTT
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS6
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring