Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xksu-A1

[Submit comment/correction]

Locus	Xksu-A1
Type	RFLP
Map	Oat-KxO-27 25 Oat-KxO/AFLP-27 54 Oat-KxO/Q-27 25
	[ Show Nearby Loci ]
QTL with Locus Marker	Groat percentage, KxO-27 Test weight, KxO-27-a Test weight, KxO-27-c
Map Data	Oat, KxO Oat, KxO, AFLP Oat, KxO/QTL
Probe	pTtksuA1
Image	KSUA1 KO autoradiogram
Reference	Jin H et al. (2000) Combined AFLP and RFLP mapping in two hexaploid oat recombinant inbred populations Genome 94-101.
Probe for Locus	pTtksuA1
Locus	Xksu-A1 [ Show all 26 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AAGATTGTCAACAAGTGCC L:CAACAGAGATATTGCCGTAG
Polymorphism	KSUA1 DraI KSUA1 XbaI KSUA1 EcoRI KSUA1 EcoRV KSUA1 HindIII
Linkage Group	7D / 7DS Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.2